PubMedCrossRef 23. Lukomski S, Hoe NP, Abdi I, Rurangirwa J, Kordari P, Liu M, Dou SJ, Adams GG, Musser JM: Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization. Infect Immun 2000, 68:535–542.PubMedCrossRef 24. Okada N, Tatsuno I, Hanski E, Caparon

M, Sasakawa C: Streptococcus pyogenes protein F promotes invasion of HeLa cells. Microbiology PFT�� cost 1998, 144:3079–3086.PubMedCrossRef 25. Olsen RJ, Shelburne SA, Musser JM: Molecular mechanisms underlying group A streptococcal pathogenesis. Cell Microbiol 2009, 11:1–12.PubMedCrossRef Authors’ Ricolinostat research buy contributions IT conceived the study. IT and TH designed and performed the experimental work with selleck screening library help by MI and MM. All authors contributed to analyze data. IT wrote the original manuscript. TH helped to craft the final manuscript. All authors approved the final manuscript.”
“Background Antibiotic-resistant bacteria have been found in a surprisingly diverse range of environments, including human clinics, animal husbandry, orchards, aquaculture, food, sewage, chlorinated, and unchlorinated water supplies [1]. Antimicrobial resistance has become

a major medical and public health problem as it has direct links with disease management [2]; and while antibiotics such as tetracycline, doxycycline, norfloxacin, ciprofloxacin and streptomycin may be used as an adjunct in rehydration therapy and are critical in the treatment of septicemia patient [3–5], resistance to many of these drugs in many pathogens including Vibrio Adenosine pathogens such as V. vulnificus, V. cholerae, V. fluvialis and V. parahaemolyticus [6–8] have been documented. Report of drug-resistant V. cholerae strains are appearing

with increasing frequency [9]. Emergence of microbial resistance to multiple drugs is a serious clinical problem in the treatment and containment of the cholera-like diarrhoea, as reflected by the increase in the fatality rate from 1% to 5.3% after the emergence of drug-resistance strains in Guinea-Bissau during the cholera epidemic of 1996-1997 [10]. A genetic element, termed SXT element, which has properties similar to those of the conjugative transposons, was found to carry genes encoding resistance to sulfamethoxazole, trimethoprim and streptomycin in V. cholerae O139 and O1 strains isolated in India, but was not present in O1 strain obtained in 1994 from Rwandan refugees in Goma, Zaire [11]. Previous report showed that gene cassettes contained in class 1 integrons were distributed among different V. cholerae O-serotypes of mainly clinical origin in Thailand [12]. Also, the presence and transfer of SXT element and resistance gene in class 1 integrons have been studied in South Africa [13], which reported for the first time the presence of SXT element in V. cholerae O1 clinical isolates in Africa [13].

2 nd, not determined; alphanumeric nomenclature as defined by Pavlik et al., 1999 [17], alphabetic nomenclature correspond to new profiles identified in this study. 3 Nomenclature as defined by Stevenson et al., 2002 [8]. 4 Nomenclature as defined by Thibault et al., 2007 [11]. 5 Number of repeats at locus 292-X3-25-47-3-7-10-32

defined by Thibault et al., 2007 [11]. 6 +, presence; -, absence. IS900-RFLP method Map strains were typed by IS900-RFLP as Go6983 solubility dmso described previously [11]. Profiles were designated according to nomenclature previously described [17, 20–22]. Profiles were analysed using Bionumerics™ software version 6.5 (Applied Maths, Belgium). PFGE analysis PFGE analysis was carried out using SnaBI and SpeI according to the published standardized procedure of Stevenson et al. [8] with the following modifications. Plugs were prepared to yield a density of 1.2 × 1010 cells ml-1 and the incubation time in lysis buffer was increased to 48 hr. The concentration of lysozyme was increased to 4 mg ml-1. Incubation with proteinase K was carried out for a total of seven days and the enzyme was refreshed after four days. Restriction of plug DNA by SpeI was performed with 10U overnight after which the enzyme was refreshed

and incubated for a further 6 hr. The parameters for electrophoresis of SpeI restriction https://www.selleckchem.com/products/pf-06463922.html fragments were changed to separate fragments of between 20 and 250Kb as determined by the CHEF MAPPER and electrophoresis was performed for 40 hr. Gel images were captured using an Alphaimager 2200 (Alpha Innotech). Profiles were analysed using Bionumerics™ software version 6.5 (Applied Maths, Belgium). SNP analysis of gyrA and gyrB genes Primers (Additional file 2: Table S2) were designed for both gyrA (GenBank accession no. 2720426

[Genome number: NC_002944.2]) and gyrB genes (GenBank accession no. 2717659 [Genome number: NC_002944.2]). The PCR mixture was composed as follows using the GoTaq Flexi DNA polymerase (Promega). Two microliters of DNA PAK5 solution was added to a final volume of 50 μl containing 0.2 μl of GoTaq Flexi DNA polymerase (5 U/μl), 2 mM (each) dATP, dCTP, dGTP, and dTTP (Promega); 10 μl of 5x PCR buffer supplied by the manufacturer; 1 μM of each primers; and 1.5 mM of MgCl2. The reactions were carried out using a TC-512 thermal cycler (Techne). PCR conditions were as follows: 1 cycle of 5 min at 94°C; 30 cycles of 30 s at 94°C, 30 s at 58°C, and 30 s at 72°C; and 1 cycle of 7 min at 72°C. PCR products were visualized by electrophoresis using 1.5% agarose gels (agarose electrophoresis grade; Invitrogen), purified using NucleoSpin® Extract II (Macherey-Nagel) and AZD8931 sequenced by GenomExpress (Grenoble, France). Sequence analysis and SNP detection were performed by using the Bionumerics™ software version 6.5 (Applied Maths, Belgium). LSP analysis Primers were used according to Semret et al.

R. Geßner 1:1,000 As expected, M2-Pk staining in CDE livers was more intense than in control livers. We validated the gain of M-Pk expression by Q-RT-PCR with different primer pairs, which amplify either both splice forms of M-Pk (primer pair 1; Table 2) or only M2-Pk (primer pair 3; Table 2) or M1-Pk (primer pairs 4, 5 and 6; Table 2) (Figure 2A). The identity of mouse M1-Pk was determined by sequencing of partial cDNA clones (M-Pk-up and M-Pk-down primer; additional File 3) derived from mouse heart, because this tissue is known to express solely M1-Pk. A strong up-regulation of both splice variants in

livers of CDE treated mice was detected (Figure 2A). Table 2 Primers.   Upper primer Lower primer Accession number BAY 63-2521 nmr Adipophilin ccctgtctaccaagctctgc cgatgcttctcttccactcc NM_007408 L-Pk ttctgtctcgctaccgacct cctgtcaccacaatcaccag NM_013631 GFAP cacgaacgagtccctagagc atggtgatgcggttttcttc NM_012773 Vimentin atgcttctctggcacgtctt

agccacgctttcatactgct NM_011701 Nestin gatcgctcagatcctggaag R406 cost gagaaggatgttgggctgag NM_016701 PECAM1(CD31) tgcaggagtccttctccact acggtttgattccactttgc NM_008816 CD14 ctgatctcagccctctgtcc gcttcagcccagtgaaagac NM_009841 Cyclophilin aagactgaatggctggatgg ttacaggacattgcgagcag NM_008907 E-cadherin tgctgattctgatcctgctg ggagccacatcatttcgagt NM_009864 N-cadherin ctgggacgtatgtgatgacg ggattgccttccatgtctgt NM_007664 LI-cadherin cctgaagcccatgacattct ccgctcttgtttctctgtcc NM_019753 M-Pk-pair 1 gcatcatgctgtctggagaa gtaaggatgccgtgctgaat NM_011099 M-Pk pair 3 tcgaggaactccgccgcctg gtaaggatgccgtgctgaat LY294002 research buy NM_011099 M-Pk pair 4 cagacctc atggaggcca tgg gtaag gatgccgtgctgaat Heart cDNA and NM_011099 M-Pk-pair 5 tgtttagcagcagctttg ctatcattgccgtgactcga Heart cDNA and NM_011099 M-Pk-pair 6 caccgtctgctgtttgaaga ctatcattgccgtgactcga Heart cDNA and NM_011099 Figure 2 Quantification of biomarkers in liver extracts of CDE treated mice. Q-RT-PCR of total M-Pk, M1-Pk

ever and M2-Pk with different primer pairs as indicated (A) and Q-RT-PCR of ADRP, a marker for lipid deposition in hepatocytes, L-Pk (exclusively expressed in hepatocytes), GFAP (classical marker of HSCs), vimentin (common marker of Kupffer cells, SECs, activated HSCs and fibroblasts), nestin (HSC marker), PECAM (CD31, marker for endothelial cells) and CD14 (cell surface marker of monocytes/macrophages like Kupffer cells) (B). Six treated mice were compared to six untreated age-matched mice. Reference line represents means in untreated mice set 100%. Statistical significant differences P < 0.05 (Mann Whitney ranks sum test) are indicated by an asterisk. Both, the elevation of M1-Pk and M2-Pk on RNA level and the increase of M-Pk positive cells point to expansion of sinusoidal cells due to CDE diet.

Polyphenolic compounds have been classified find more into several groups, including hydroxybenzoic acids, hydroxycinnamic acids, coumarins, xanthones, stilbenes, antraquinones, lignans and flavonoids (Manach et al., 2005). The largest and best known group among the polyphenolic compounds are flavonoids. The basic skeleton of flavonoid molecule consists of 15 carbon atoms (formula C6–C3–C6) forming the two benzene rings (A- and B-ring), between which there is a three-carbon unit (C3) closed in the heterocyclic pyran or pyrone ring (C-ring). Flavonoids are divided into six subgroups: anthocyanins, flavanols, flavanones, flavones, flavonols and isoflavones

(Ullah and Khan, 2008). In our study we tested 20 polyphenolic compounds occurring most abundantly in nature and belonging to the main group of polyphenols (Fig. 6) at the highest used concentration of 1,000 μM. The results, presented in Table 1, demonstrate that of all polyphenolic compounds examined in this study, only six belonged to the flavonoid class [cyanidin, quercetin, silybin, cyanin, (+)-catechin and (−)-epicatechin] and had inhibitory effect on thrombin activity (the strongest effect showed cyanidin and quercetin). According to our observations, flavonoids which inhibit thrombin amidolytic activity Quisinostat mw belong to flavanols,

Selleck Sotrastaurin flavonols anthocyanins (aglycones with –OH substituents at the position of R1 and R2 in the B-ring). Only silybin has a methoxy group at the R1 position. These results are consistent with data presented by Mozzicafreddo et al. (2006). They also reported that flavonoids showed an inhibitory effect on thrombin amidolytic activity. Jedinák et al. (2006) demonstrated that silybin and quercetin strongly inhibited thrombin’s ability to hydrolyze N-benzoyl-phenylalanyl-valyl-arginine-paranitroanilide Fenbendazole (IC50 for silybin was 20.9 μM, and for quercetin 30.0 μM, respectively at 0.6 mM substrate concentration). In their study these flavonoids also showed very strong inhibitory effect on trypsin and urokinase amidolytic activity (for trypsin, silybin IC50 was 3.7 μM and quercetin IC50 was 15.4 μM, while for urokinase, silybin

IC50 was 21.0 μM and quercetin IC50 was 12.1 μM). We also studied the effect of DMSO on thrombin activity at the same concentration as used in the case of polyphenolics dissolved in this solvent. After 5 % DMSO treatment, we did not observe any influence on thrombin activity. Fig. 6 Chemical structures of polyphenolic compounds used in the study. Chemical formulas were downloaded from http://​pubchem.​ncbi.​nlm.​nih.​gov/​ as InChI. The visualization of chemical formulas was performed using ChemBioDraw Ultra Software from ChemBioOffice® Ultra 12.0. suite The most important function of thrombin is its proteolytic activity against fibrinogen and platelet PAR receptors. Thrombin has much higher affinity to these molecules, than to smaller compounds such as the chromogenic substrate (Crawley et al., 2007).

FEMS Microbiol Ecol 2003, 45:39–47.PubMedCrossRef 46. Elbeltagy A, Nishioka K, Sato T: Endophytic colonization and in plant nitrogen fixation by a Herbaspirillum sp. Isolated from wild rice species. Appl Environ Microbiol 2001, 67:5285–5293.PubMedCrossRef

47. Rothballer M, Schmid M, Klein I, Gattinger A, Grundmann S, Hartmann A: Herbaspirillum hiltneri sp. nov., isolated from surface-sterilized wheat roots. In J Syst Evol Microb 2006, 56:1341–1348.CrossRef 48. Jung SY, Lee MA, Oh TK, Yoon JH: In J Syst Evol Micr. 2007, 57:2284–2288.CrossRef 49. Rothballer M, Eckert B, Schmid check details M, Fekete A, Schloter M, Lehner A, Pollmann S, Hartmann A: Endophytic root colonization of gramineous plants by Herbaspirillum frisingense . FEMS Microbiol Ecol 2008, 66:85–95.PubMedCrossRef 50. Xiao Y, Lu Y, Heu S, Hutcheson SW: Organization and environmental regulation of the Pseudomonas syringae pv. syringae 61 hrp cluster. J Bacteriol 1992, 174:1734–1741.PubMed 51. Frederick RD, Ahmad M, Majerczak DR, Arroyo-Rodríguez AS, SC79 ic50 Manulis S, Coplin DL: Genetic organization of the Pantoea stewartii subsp. stewartii hrp gene cluster and sequence analysis of the hrpA, hrpC, hrpN, and wtsE operons. Mol Plant Microbe SBI-0206965 chemical structure 2001, 14:1213–1222.CrossRef 52. Wengelnik K, Van den Ackerveken G, Bonas U: HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two-component

response regulators. Mol Plant Microbe In 1996, 9:704–712.CrossRef 53. Brito B, Marenda M, Barberis P, Boucher C, Genin S: prhJ and hrpG , two new components of the plant signal-dependent regulatory cascade controlled by PrhA in Ralstonia solanacearum

. Mol Microbiol 1999, 31:237–251.PubMedCrossRef 54. Lindgren PB: The role of hrp genes during plant-bacterial interactions. Ann Rev Phytopathol 1997, 35:129–152.CrossRef 55. Cho HJ, Park YJ, Noh TH, Kim YT, Kim JG, Song ES, Lee DH, Lee BM: Molecular analysis of the hrp gene 17-DMAG (Alvespimycin) HCl cluster in Xanthomonas oryzae pathovar oryzae KACC10859. Microb Pathogenesis 2008, 44:473–483.CrossRef 56. Lorenz C, Büttner D: Functional characterization of the type III secretion ATPase HrcN from the plant pathogen Xanthomonas campestris pv. vesicatoria. J Bacteriol 2009, 191:1414–1428.PubMedCrossRef 57. van Gijsegem F, Vasse J, de Rycke R, Castello P, Boucher C: Genetic dissection of Ralstonia solanacearum hrp gene cluster reveals that the HrpV and HrpX proteins are required for Hrp pilus assembly. Mol Microbiol 2002, 44:935–946.PubMedCrossRef 58. Marie C, Broughton WJ, Deakin WJ: Rhizobium type III secretion systems: legume charmers or alarmers? Curr Opin Plant Biol 2001, 4:336–342.PubMedCrossRef 59. Kambara K, Ardissone S, Kobayashi H, Saad MM, Schumpp O, Broughton WJ, Deakin WJ: Rhizobia utilize pathogen-like effector proteins during symbiosis. Mol Microbiol 2009, 71:92–106.PubMedCrossRef 60. Sambrook J, Fritsch EF, Maniatis T: Molecular cloning: a laboratory manual.

Finally, we note that there is a fourth, smaller peak at m/z 1194 in the MALDI-TOF spectrum (Figure 2A), which may correspond to a cyclized form of this larger pyoverdine species. Table 3 Negative ions arising from MS/MS analysis of the m/z = 1141 pyoverdine species Peak number Mass Composition of ion 1 357.13 B ion: CHR 2 458.24 B ion: CHR_K 3 616.28 B ion: CHR_K_OH-D 4 718.32 B ion: CHR_K_OH-D_T 5 818.39 B PHA-848125 concentration ion: CHR_K_OH-D_T_T 6 905.42 B ion: CHR_K_OH-D_T_T_S 7 1036.41 B ion: CHR_K_OH-D_T_T_S_OH-D Y1 1067.48 Y ion resulting from loss of chromophore acyl group Fragmentation of the m/z = 1141 pyoverdine species resulted in identification of the following negative ions as

shown in Figure 2B. Peaks 1-7 match the expected pattern of B-ions previously reported for fragmentation of other P. syringae linear pyoverdine molecules. Y1 has the expected mass for the Y ion resulting from loss of the acyl group of the chromophore. CHR = chromophore, OH-D = hydroxyaspartate, all

other amino acids indicated by standard one letter code. Table 4 Negative ions arising from MS/MS analysis of the m/z = 1212 pyoverdine species Peak number Mass Mass difference with equivalent Bortezomib cost peak in Table 3 CHR 357.13 0 1 428.12 70.99 2 529.23 70.99 3 687.27 70.99 4 789.30 70.98 5 889.38 70.99 6 976.43 71.01 7 1107.40 70.99 Y1 1138.47 70.99 Fragmentation of the m/z = 1212 pyoverdine species resulted in identification of the following negative ions as shown in Figure 2C. The numbering and spacing of ions is identical to those listed in Table 3, but with peak 1 now representing the chromophore bearing an unknown 71 Da substituent. Y1 has the expected mass for the Y ion resulting from loss of the acyl group of the chromophore (allowing for the unknown Dynein 71 Da substituent). I BET 762 Genetic and biochemical analysis of the pyoverdine NRPS genes To confirm that each

of the putative pyoverdine NRPS genes was indeed required for pyoverdine biosynthesis, these were individually deleted in-frame from the chromosome using a rapid overlap PCR-based method [37, 38]. When grown on iron-limiting King’s B (KB) media [39] each NRPS gene deletion strain lacked the UV fluorescence of wild type (WT) (Figure 3A). Likewise, each of the gene deletion strains was impaired in siderophore production, assessed following 24 h growth on CAS agar plates at 28°C (Figure 3B); and was unable to grow on KB agar plates containing 200 μg/ml EDDHA (ethylene-diamine-di-hydroxyphenylacetic acid, an iron chelating agent that establishes a strong selective pressure for effective siderophore-mediated iron transport; Figure 3C). These phenotypes confirmed that none of the gene deletion strains were able to produce pyoverdine. Successful restoration of pyoverdine synthesis by complementation in trans indicated that these phenotypes did not result from polar effects.

As before, an OTU is considered to be shared if it is found in at least one member of each of the two species/groups compared. The highest amount of OTU-sharing is indeed between chimpanzees and bonobos (18.0%) and DRC and SL humans (24.2%), with less OTU-sharing between any ape and any human group (7.8 – 18.0%). The chimpanzees do share more OTUs with the SL humans at the same sanctuary (13.8%)

than with the DRC humans at the bonobo sanctuary (7.8%), which could indicate a greater influence of environment/contact in this case. However, the bonobos and DRC humans share 13.7% of their OTUs, selleck kinase inhibitor which is actually less than the fraction of OTUs (18.0%) shared between bonobos and SL humans. Overall these results do not make a compelling case for a major influence of environment/contact on the saliva microbiomes

of human workers and apes at the same sanctuary. We also investigated this issue with respect to the zoo apes, as here we have different species living in close proximity. As shown in Additional file 5: Table S4, there is on average higher OTU-sharing between the various pairs of zoo apes than between apes and humans in the sanctuaries: the average OTU-sharing between species is 20.6% for the zoo apes vs. 13.8% between PD-332991 apes and human workers at the same sanctuary. Thus, the zoo environment does appear to have significantly enhanced the sharing of OTUs among the different ape species. Discussion and conclusions We selleck provide here the first comparative analysis of the saliva microbiome of bonobos, chimpanzees and humans. We find greater similarity

in the composition of the saliva microbiome between bonobos and chimpanzees, and between human workers at the same sanctuaries. These results suggest that internal factors, related to phylogeny or host physiology, have a more important influence on the saliva microbiome than does geography or local environment. Phylogeny (i.e., vertical transmission of the microbiome) has been previously implicated in an analysis of the fecal microbiome from wild apes [9] and is in keeping with mother-child and twin studies of the oral microbiome that found a greater role for vertical than horizontal transmission [23, 24]. However, a recent study of mothers and infants found a higher correlation among the microbiomes of infants and of mothers than of infants with their mothers [25], suggesting that diet related aspects of host APR-246 physiology may also play a role. Our results are compatible with either phylogeny or dietary factors related to host physiology (e.g., proportion of meat in the diet) – or both – as the primary influence(s) on the saliva microbiome.

Each experiment was repeated three to four times and one standard deviation is shown. The structures of Trp, Ind, IAA, I3CA, IAN, I3A, TM, and OI are shown. The asterisk indicates statistical significance determined using a Student Ro 61-8048 datasheet t test (P < 0.05). Most interestingly, a plant auxin, 3-indolylacetonitrile dramatically (up to 2900-fold) decreased the heat-resistant CFU of P. alvei in a dose dependent manner at 16 and 30 hr (Figure 2B and Figure 4A), while another auxin 3-indoleacetic acid had a less significant influence,

and tryptamine and 2-oxindole had no effect (Figure 4A). Therefore, these results suggest that the functional groups of indole derivatives may control the development of P. alvei spores. Similar to indole, the proportion of sporulating cells in the total click here number of cells was similar with

and without treatment of 3-indolylacetonitrile (upper panel in Figure 3). Also, 3-indolylacetonitrile produced an irregular spore coat, while no treatment produced sturdy coat (Figure 3). Therefore, it appeared that indole and 3-indolylacetonitrile inhibited spore maturation rather than sporulation initiation. In order to understand how most spores (upper panel in Figure 3) in the presence of indole and 3-indolylacetonitrile could not survive against heat treatment, the lysozyme resistance assay [36] was performed with 30-hour grown cells since the lysozyme treatment could release all spores. As a result, indole and 3-indolylacetonitrile

produced a large portion of lysozyme-resistant PND-1186 mw cells (47 ± 8% with indole and 50 ± 3% with 3-indolylacetonitrile) which are probably the number of total spores, while indole and 3-indolylacetonitrile produced only 6.7 ± 0.9% and 1.5 ± 0.1% heat-resistant cells (Figure 2C); hence it appeared that a large number of spores have some spore defect for heat resistance. Therefore, it appeared that the low heat-resistant CFU was caused by some spore defect or the altered spore structure. Furthermore, the effect of indole and 3-indolylacetonitrile was investigated using another spore-forming medium, Brain Heart Infusion (BHI) agar for a longer incubation time (here, 14 days) when sporulation process would be completed. Similar to DSM medium, indole (1 mM) and 3-indolylacetonitrile (1 mM) inhibited the heat-resistant CFU of P. alvei (17 ± 10% and 16 ± 1%), compared to no addition of exogenous Carnitine palmitoyltransferase II indole (77 ± 3%). Therefore, the inhibitory impact of indole and 3-indolylacetonitrile was effective in different media for a long term, while their effect on heat resistance was attenuated with a longer incubation time. Effect of indole and indole derivatives on cell growth To test the toxicity of indole and indole derivatives, cell turbidity at 16 hr and the specific growth rates with indole and 3-indolylacetonitrile were measured. Most indole derivatives at the concentration tested (1 mM) did not have much of an inhibition effect on the cell growth of P.

This study was supported by funds from National Institutes of Health grant U54-AI057157 (Southeast

Regional Center www.selleckchem.com/products/GDC-0449.html for Biodefense and Emerging Infectious Diseases) to V. L. M. (project 006) and to the Animal Models and Flow, Biomarker and this website Imaging Cores of the Southeastern Regional Center of Excellence for Emerging Infections and Biodefense (to R. F. and G. D. S.). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIH. References 1. Zietz BP, Dunkelberg H: The history of the plague and the research on the causative agent Yersinia pestis. Int J Hyg Envir Heal 2004,207(2):165–178.CrossRef 2. Zhou D, Yang R: Molecular Darwinian evolution of virulence in Yersinia pestis. Infect Immun Nec-1s 2009,77(6):2242–2250.PubMedCrossRef 3. Perry RD, Fetherston JD: Yersinia pestis–etiologic agent of plague.

Clin Microbiol Rev 1997,10(1):35–66.PubMed 4. Anisimov AP, Amoako KK: Treatment of plague: promising alternatives to antibiotics. J Med Microbiol 2006,55(Pt 11):1461–1475.PubMedCrossRef 5. Gage KL, Kosoy MY: Natural history of plague: perspectives from more than a century of research. Annu Rev Entomol 2005, 50:505–528.PubMedCrossRef 6. Stenseth NC, Atshabar BB, Begon M, Belmain SR, Bertherat E, Carniel E, Gage KL, Leirs H, Rahalison L: Plague: past, present, and future. PLoS Med 2008,5(1):e3.PubMedCrossRef 7. Bitam I, Dittmar K, Parola P, Whiting MF, Raoult D: Fleas and flea-borne diseases. Int J Infect Dis 2010,14(8):e667-e676.PubMedCrossRef 8. Galimand M, Carniel E, Courvalin P: Resistance of Yersinia pestis to antimicrobial agents. Antimicrob Agents Chemother 2006,50(10):3233–3236.PubMedCrossRef 9. Smiley ST: Immune

defense against pneumonic plague. Immunol Rev 2008, 225:256–271.PubMedCrossRef 10. Prentice MB, Rahalison L: Plague. Lancet 2007,369(9568):1196–1207.PubMedCrossRef 11. Wimsatt J, Biggins DE: A review of plague persistence with special emphasis on fleas. J Vec Born Dis 2009,46(2):85–99. 12. Marketon MM, DePaolo RW, DeBord KL, Jabri B, Schneewind O: Plague bacteria target immune cells during infection. Science (New York, NY) 2005,309(5741):1739–1741.CrossRef Erythromycin 13. DeLeo FR, Hinnebusch BJ: A plague upon the phagocytes. Nat Med 2005,11(9):927–928.PubMedCrossRef 14. Matsumoto H, Young GM: Translocated effectors of Yersinia. Curr Opin Microbiol 2009,12(1):94–100.PubMedCrossRef 15. Guinet F, Avé P, Jones L, Huerre M, Carniel E: Defective innate cell response and lymph node infiltration specify Yersinia pestis infection. PLoS One 2008,3(2):e1688.PubMedCrossRef 16. Sebbane F, Gardner D, Long D, Gowen BB, Hinnebusch BJ: Kinetics of disease progression and host response in a rat model of bubonic plague. Am J Pathol 2005,166(5):1427–1439.PubMedCrossRef 17. Massoud TF, Gambhir SS: Molecular imaging in living subjects: seeing fundamental biological processes in a new light. Genes Dev 2003,17(5):545–580.PubMedCrossRef 18.

77 0.250 1.65 0.628

4.14 0.066 9.74 pS88017   Putative enolase 1.47 0.573 5.44 0.152 7.98 0.040 18.68 pS88019 sitD SitD protein; iron transport find more protein 4.54 0.020 38.23 0.003 26.29 0.004 139.75 pS88022 sitA SitA protein; iron transport protein 17.79 0.002 49.52 0.003 83.87 0.001 776.05 pS88026   Hypothetical protein 1.32 0.633 1.04 GSK2126458 molecular weight 0.959 1.02 0.981 / c pS88027   Hypothetical protein; putative exported protein 0.70 0.626 1.04 0.956 0.31 0.187 / pS88028   Conserved hypothetical protein 1.11 0.809 0.75 0.577 1.16 0.762 / pS88029   Conserved hypothetical protein 1.30 0.712 1.22 0.751 2.20 0.260 / pS88030   Conserved hypothetical protein 0.30 0.098 0.46 0.308 0.32 0.143 1.09 pS88031   Hypothetical protein 0.67 0.405 0.97 0.959 1.58 0.369 2.08 pS88037 sopA

SopA protein (Plasmid partition protein A) 0.60 0.227 0.47 0.147 1.12 0.847 0.98 pS88038 sopB SopB protein (Plasmid partition protein B) 0.38 0.021 0.91 0.879 1.41 0.696 3.32 pS88039   Hypothetical protein 0.63 0.312 2.19 0.330 3.82 0.031 2.96 pS88040   Conserved hypothetical protein 0.73 0.510 2.74 0.240 3.61 0.031 3.61 pS88041   Hypothetical protein 1.39 0.295 0.42 0.174 1.77 0.092 1.47 pS88043   Hypothetical protein 0.89 0.782 1.47 0.378 2.00 0.188 1.83 pS88044 yubI Putative antirestriction protein 1.35 0.720 1.13 0.890 0.99 0.991 3.38 pS88045   Conserved hypothetical protein 0.95 0.919 1.66 0.403 1.09 0.873 4.52 pS88046   Conserved hypothetical protein 0.80 0.717 1.38 0.661 1.25 0.735 2.07 pS88047 ydbA Conserved hypothetical protein 1.71 0.542 0.99 0.987 1.33 0.739 4.18 pS88048 ydcA Putative adenine-specific DNA methylase 1.44 Tipifarnib mouse 0.652 1.09 0.917 1.52 0.606 3.98 pS88050 ssb Single-stranded DNA-binding protein 1.56 0.383 2.42 0.152 1.96 0.211 2.91 pS88051 yubL Conserved hypothetical protein

0.90 0.832 1.21 0.842 2.13 0.203 2.05 pS88054 Ponatinib mouse ycjA Putative DNA-binding protein involved in plasmid partitioning (ParB-like partition protein) 1.31 0.260 2.60 0.392 3.45 0.007 2.30 pS88055 psiB Plasmid SOS inhibition protein B 0.74 0.414 5.34 0.094 3.26 0.026 4.03 pS88056 psiA Plasmid SOS inhibition protein A 1.67 0.321 13.06 0.048 6.44 0.016 3.02 pS88057 flmC Putative F-plasmid maintenance protein C 2.27 0.144 0.55 0.346 0.65 0.401 2.21 pS88059 yubN Conserved hypothetical protein 2.01 0.441 0.90 0.902 1.20 0.826 3.52 pS88060 yubO Conserved hypothetical protein 1.13 0.781 1.79 0.211 2.24 0.075 3.89 pS88061 yubP Conserved hypothetical protein 1.43 0.397 2.40 0.109 1.72 0.408 4.27 pS88062 yubQ X polypeptide (P19 protein); Putative transglycosylase 0.94 0.948 0.88 0.910 1.20 0.852 4.90 pS88063 traM Protein TraM (Conjugal transfer protein M) 0.77 0.313 0.94 0.866 0.92 0.769 0.25 pS88064 traJ Protein TraJ (Positive regulator of conjugal transfer operon) 0.39 0.212 2.86 0.310 1.08 0.898 1.98 pS88066 traA Fimbrial protein precursor TraA (Pilin) 1.59 0.053 0.54 0.188 0.19 0.004 0.21 pS88092 traT Complement resistance and surface exclusion outer membrane protein TraT 0.27 0.265 0.