Age-related taste cell generation in circumvallate papillae organoids via regulation of
multiple signaling pathways
Wenwen Ren, Quan Liu, Xiujuan Zhang, Yiqun Yu
PII: S0014-4827(20)30397-9
DOI: https://doi.org/10.1016/j.yexcr.2020.112150
Reference: YEXCR 112150
To appear in: Experimental Cell Research
Received Date: 28 February 2020
Revised Date: 11 June 2020
Accepted Date: 14 June 2020
Please cite this article as: W. Ren, Q. Liu, X. Zhang, Y. Yu, Age-related taste cell generation in
circumvallate papillae organoids via regulation of multiple signaling pathways, Experimental Cell
Research (2020), doi: https://doi.org/10.1016/j.yexcr.2020.112150.
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition
of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of
record. This version will undergo additional copyediting, typesetting and review before it is published
in its final form, but we are providing this version to give early visibility of the article. Please note that,
during the production process, errors may be discovered which could affect the content, and all legal
disclaimers that apply to the journal pertain.
© 2020 Published by Elsevier Inc.
Wenwen Ren: Conceptualization; Data curation; Formal analysis; Funding acquisition;
Methodology; Writing – original draft.
Quan Liu: Data curation; Formal analysis; Writing – review & editing.
Xiujuan Zhang: Data curation; Formal analysis; Writing – original draft.
Yiqun Yu: Conceptualization; Data curation; Formal analysis; Funding acquisition;
Investigation; Methodology; Project administration; Supervision; Writing – original
draft; Writing – review & editing.
Age-related taste cell generation in circumvallate papillae organoids
via regulation of multiple signaling pathways
Running title: Taste cell generation in organoids
Wenwen Ren#1,2, Quan Liu#1, Xiujuan Zhang#1, Yiqun Yu*1
1. Department of Otolaryngology, Eye, Ear, Nose and Throat Hospital, Shanghai Key
Clinical Disciplines of Otorhinolaryngology, Fudan University, Shanghai, China
200031.
2. Institutes of Biomedical Sciences, Fudan University, Shanghai 200031 China
# These authors contributed equally.
*Corresponding author:
Dr. Yiqun Yu, [email protected]
Department of Otolaryngology, Eye, Ear, Nose and Throat Hospital,
Fudan University, Shanghai, China.
83 Fen Yang Road, Shanghai, CHINA. 200031
Tel: 86-21-64377134, Fax: 86-21-64377151.
Declarations of interest: none
Abstract
Sense of taste is central to evaluate food before digestion. Taste stem cells undergo
constant differentiation throughout the life. However, the mechanism underlying the
generation of taste receptor cells is still not clear. Here, we cultured taste organoids
from either Lgr5+ or Lgr5- cells, and found the preferential generation of Car4+ and
Gustducin+ taste receptor cells in organoids derived from Lgr5+ cells in circumvallate,
foliate or fungiform papillae. Taste organoids derived from Lgr5+ cells in
circumvallate papillae of neonatal mice showed stronger capacity to generate taste
receptor cells compared to the organoids from Lgr5+ cells of the adult circumvallate
papillae. Massive transcriptional differences were found in multiple signaling
pathways including taste transduction between organoids derived from circumvallate
papillae of adult and neonatal mice. Inhibiting the Notch signaling pathway by
LY411575 enhanced taste receptor cell generation in organoids from circumvallate
papillae and modulated multiple signaling pathways. Thus, we concluded that
receptor cell generation in taste organoids was age-related and regulated via multiple
signaling pathways.
Keyword: Taste organoid; circumvallate papillae; Lgr5; age; Car4; Gustducin;
signaling pathway.
Introduction
Taste buds are clusters of polarized sensory cells embedded in three taste papillae,
namely circumvallate (CV) and foliate (FL) papillae on posterior tongue, as well as
fungiform (FF) papillae on anterior tongue [1]. Based on morphological and
functional classification, there are three principal types of taste cells in a single taste
bud [2]. Type I are undifferentiated and immature taste cells, and most of them are
supporting or glia-like cells wrapping around other cell types, marked by NTPDase2
that converts ATP to ADP as ATP from taste receptor cells activates purinergic
receptors on taste sensory afferents [3, 4]. Type II cells express the G-protein coupled
taste receptors, sensing sweet, umami and bitter signals and release ATP when
activated [5]. Type III taste cells are responsible for transduction of salt and sour
stimuli and make conventional synaptic contacts on afferent nerve fibers [6-8]. In
rodent, the average life span of taste cells ranges from 8 to 12 days [9, 10], although
this varied for different cell types [9].
In mice, taste placodes develop as early as at E12, and taste papillae are well
formed by E18.5 [1, 11]. However, until the first postnatal week, taste buds do not
express specific taste cell markers, especially in CV and FF papillae [6, 11, 12].
Multiple pathways are involved in regulating taste cells development [13]. For
instance, Wnt/β-catenin signaling plays critical roles in the morphogenesis of taste
papillae and taste buds [14]. Through interacting with Shh, Wnt/β-catenin signaling
regulates the development of FF papillae [15]. Meanwhile, Shh signaling participates
in the formation and maintenance of taste buds in FF papillae[16]. Besides, Notch
signaling related genes are highly expressed in taste tissue and function in cell lineage
determination and cell turnover[17, 18].
Lgr5, a well-established stem cell biomarker in multiple tissues, marks adult taste
stem/progenitor cells in posterior tongue. Lgr5 is selectively expressed in CV and FL
but not in FF papillae or the surrounding epithelium in adult mice [19]. At prenatal
stage, Lgr5 is found to be expressed in both anterior and posterior tongue at as early
as E13.5 and give rise to the anterior and posterior taste buds [20]. When the tongue is
injured by glossopharyngeal nerve transection, only the posterior taste buds are
regenerated from Lgr5+ cells [20]. Using Matrigel-based 3D culture system, Ren and
colleagues establish taste organoids in vitro from Lgr5+ cells in CV papillae collected
by fluorescence-activated cell sorting (FACS) [21]. Furthermore, unsorted mixture of
Lgr5+ and Lgr5- cells from adult CV papillae form ~80% of Lgr5-EGFP+ taste
organoids in vitro [13]. However, there is no evidence showing that taste organoids
are established from the Lgr5+ cells in anterior tongue.
Based on the above findings, here we cultured taste organoids from both posterior
and anterior tongue of neonatal mice. We found that organoids from Lgr5+ cells
showed higher yields of taste cells compared to organoids from Lgr5- cells. The
organoids from Lgr5+ cells of CV papillae of neonatal mice had stronger capacity to
generate taste receptor cells compared to organoids from CV papillae of adults, with
transcriptional difference in taste transduction as well as multiple signaling pathways.
Furthermore, generation of taste cells was regulated in the presence of various
chemicals including Wnt activator CHIR99021 and Notch inhibitor LY411575. By
inhibiting Notch signaling in Lgr5+ cells-derived organoids from CV papillae, we
explored the difference in taste receptor cell generation and transcriptional landscape
in taste transduction as well as multiple signaling pathways. Collectively, we
concluded that preferential taste cell generation in organoids from Lgr5+ cells was
age-related and regulated via multiple signaling pathways. This provided direct
evidence to establish potential signaling transduction network underlying the taste
receptor cell generation.
Materials and Methods
Chemicals
All chemicals used in this study were purchased from Sigma Aldrich unless specified.
Chemicals and small molecules used in taste cell generation included 3 μM
CHIR99021
(6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino]
ethyl]amino]-3-pyridinecarbonitrile, #SML1046), 5 μM LY411575
(N2-[(2S)-2-(3,5-Difluorophenyl)-2-hydroxyethanoyl]-N1-[(7S)-5-methyl-6-oxo-6,7-
dihydro-5H-dibenzo[b,d]azepin-7-yl]-L-alaninamide, #SML0506), 10 μM SB202190
(4-(4-Fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)-1H-imidazole, #S7067), 100
μg/ml pVc (L-ascorbic acid 2-phosphate trisodium salt, #49752) and 2μM 616452
(2-(3-(6-Methylpyridin-2-yl)-1H-pyrazol-4-yl)-1,5-naphthyridine, Calbiochem,
446859-33-2). All these chemicals were dissolved in sterile dimethyl sulfoxide
(DMSO, D2650) to make stock solutions, which were diluted at 1000 times directly
into cultures.
Animals
The transgenic mice (Lgr5-EGFP-ires-CreERT2, Stock no. 008875) were ordered
from the Jackson Laboratory (Bar Harbor, ME). Wild type mice (adult/neonatal) were
in the C57BL/6J background and purchased from the JSJ Lab (Shanghai, China). Both
female and male mice were used. All experiments were carried out in strict
accordance with the ‘Guiding Directive for Humane Treatment of Laboratory
Animals’ issued by the Chinese National Ministry of Science and Technology. All
experiments were approved by the Shanghai Medical Experimental Animal
Administrative Committee (Permit Number 2009‐0082).
Preparation of single cell suspension
Tongues harvested from adult mice were injected with ~0.7 mL of an enzyme mixture
containing collagenase (1 mg/mL, Roche) and dispase (2 mg/mL, Roche) in Tyrode’s
solution(145 mM NaCl, 5 mM KCl, 5 mM NaHCO3, 10 mM pyruvate, 10 mM
glucose, 10 mM HEPES) for 15 ~20 min at 37 °C. The CV, FL and FF papillae areas
were dissected. We also collected the regions in the junction of corpus linguae and the
radix linguae that do not possess taste papillae as non-taste (NT) control groups.
Tissues were then cut into small pieces with scissors and digested by 0.25%
trypsin-EDTA (0.5~1mL) for 15 ~20 min at 37 °C. DTI (an equal volume of
trypsin-EDTA) was added to stop trypsinization. Then samples were centrifuged at
1,200 rpm for 3 min and supernatant was discarded. ~1mL taste culture medium (see
below) was added and tissues were mechanically dissociated into single cells using a
1mL fire-polished syringe needle. Single cell suspension was filtered with a 70-µm
and 40-µm nylon mesh cell strainers (BD Falcon). For the single cell preparation for
CV, FL and FF papillae of neonatal mice, we directly dissected and harvested the
tongue of neonatal mice without injecting the enzyme mixture, and other operation
was the same as the procedure on adults.
Flow cytometry
To obtain Lgr5+ cells, tongues from Lgr5-EGFP-ires-CreERT2 mice were digested
into single-cell suspension and filtered with a 35-µm nylon mesh (BD Falcon no.
352235) before fluorescence activated cell sorting (FACS). Lgr5+cells were sorted by
detecting the green fluorescent protein expression (excitation 488 nm, emission 530
nm). The auto fluorescent cells was eliminated by the red fluorescent protein (582 nm),
and the dead cells were eliminated by DAPI (450 nm). Cells were sorted on a BD
FACS Aria III cell sorter (BD Biosciences) in Eye, Ear, Nose and Throat Hospital,
Fudan University. Both the Lgr5+ and Lgr5- cells were collected into Low-attached
1.5mL-microcentrifuge tubes and then seeded in Low-attached 24-well plates.
Taste organoid culture
The single cell suspensions were cultured in taste organoid culture medium at 1000
cells/well in an Ultra-low-attached 24-well plate. The culture medium was based on
20% DMEM/F12 medium (Life Technologies no. 11320033), 50% Wnt3a
conditioned medium (CM) [22], 20% R-spondin CM [23], and 10% Noggin CM [13],
supplemented with epidermal growth factor (50 ng/mL, Peprotech, #315-09), N2 (1%,
ThermoFisher, #17502-048), B27 (2% (vol/vol), ThermoFisher, #17504044),
penicillin-streptomycin (100×, ThermoFisher, #15140122), HEPES (1 mM,
ThermoFisher, #15630080), Glutamax (1%, ThermoFisher, #35050061), Y-27632
(10 µM, Sigma Aldrich, #Y0503) and 3% chilled Matrigel (BD Biosciences,
#356231). The medium was changed every three to five days based on the density of
growing organoids, while organoid density was generally similar across wells. The
organoids were passaged every 10~14 days. When passaging, organoids were
collected by centrifugation at 1,200rpm for 3 min, followed by incubation in 0.25%
trypsin-EDTA at 37℃ for 10 min. Single cell suspension was made by drawing
through 1mL-microsyringe and cells were seeded in taste organoid culture medium at
density of 500 single cells per well in Ultra-low-attached 24-well plates (Corning).
Immunostaining for taste organoids
Organoids were collected and fixed in 4% paraformaldehyde for 15 minutes at room
temperature and washed with phosphate-buffered saline (PBS) for three times. Then
organoids were blocked with 5% bovine serum albumin (BSA) with 0.3% Triton
X-100 in PBS at room temperature for 1 h, and incubated with primary antibodies at
4°C overnight in a humidified chamber. After washed with PBS, the organoids were
incubated with second antibodies at room temperature for 2 h. Nuclei were
counterstained by DAPI (ThermoFisher, #D3571). The primary antibodies used in the
experiments were as follows: rat anti-K8 (Developmental Studies Hybridoma Bank,
1:10, #AB_531826), rabbit anti-Gustducin (Santa Cruz, 1:500, #AB_673678), goat
anti-CA4 (Abcam, 1:20, #AF2414), rabbit anti-NTPDase2 (Centre de Recherche du
CHUL, Quebec, Canada, 1:500, #AB_2314986). The second antibodies used in the
experiments were as follows: Alexa Fluor 488 Donkey anti‐Rabbit (ThermoFisher,
#A21206), Alexa Fluor 647 Donkey anti‐Rabbit (ThermoFisher, #A31573), Alexa
Fluor 594 Donkey anti‐Goat (ThermoFisher, #A11058), Alexa Fluor 633 Donkey
anti‐Goat (ThermoFisher, #A21082), and donkey anti-rat Alexa Fluor 647 (Abcam,
#ab150155).
Quantitative real-time PCR
For qPCR, RNA was extracted by TRIzol (ThermoFisher, #15596018) following the
manufacturer’s instructions. RNA concentration was measured with a
spectrophotometer (Metash, Shanghai, China). cDNA was synthesized via reverse
transcription using a PrimeScriptTM RT Master Mix (Takara, RR036A) following the
manufacturer’s protocols. SYBR Green qPCR SuperMix (Novoprotein, E096-01B)
was used to run real-time PCR on an Analytikjena Real-Time PCR System (Jena). β
-actin was used as a housekeeping gene for control purpose. Each experiment was in
biological triplicate. Primers used in qPCR included Gustducin: forward, CATGGCT
ACACTGGGGATTG, reverse, GATTTCAGCCAGCTGTGGAG; Car4: forward,
TGGCTCACTAACCACACCAA, reverse, GGCCTCACATTGTCCTTCAT; Entpd2:
forward, GCGCTGTAGCCATGTTCATA, reverse, AAGAGCAGCAGGAGAGCAA
C; Lgr5: forward, TAAAGACGACGGCAACAGTG, reverse, GATTCGGATCAGC
CAGCTAC; β-actin: forward, GATTACTGCTCTGGCTCCTA, reverse,
ATCGTACTCCTGCTTGCTGA.
RNA-Seq analysis
RNA-Seq analysis was conducted by Majorbio Co. (Shanghai, China). Sequencing
reads were mapped to the mouse genome using HISAT2. Transcriptome from
RNA-seq reads was reconstructed by StringTie. Expression differences were
evaluated using DESeq2. Pearson’s coefficient was calculated to determine the
correlation among different groups. The clustering analysis of the global gene
expression pattern in different samples was carried out using K-means clustering
algorithm by RSEM software. Gene Ontology (GO, http://www.geneontology.org/)
and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis
(http://www.genome.jp/kegg/) were performed. All the sequence data was analyzed
on I-Sanger (www.i-sanger.com) and deposited on NCBI Sequence Read Archive
(SRA accession: PRJNA637120).
Confocal image acquisition
All images were taken by Leica TCS SP8 confocal laser scanning microscope with
LAS AF Lite software. The contrast and brightness of the images were set in an equal
level. All images were single optical section. Image contrast and brightness was not
adjusted after acquisition.
Quantitative Analysis
The growth efficiency was denoted as the ratio between the number of organoids
generated from seeded cells and the number of seeded single cells in
Ultra-low-attached 24-well plates. The percentage of organoids containing positively
stained cells was determined by [the number of organoids containing positively
stained cells]/[the total number of organoids]. Positively stained cells were measured
by Image J software (NIH, Bethesda, MD). The number of positively stained cells and
DAPI+ cells per organoid were measured based on the immunostaining pixels by
using Image J software. The percentage of positively stained cells per organoid was
determined by [the number of positively stained cells in each organoid]/[the number
of DAPI+ cells in corresponding organoid]. Image acquisition settings were constant
among different treatments. The size of organoids was measured by SPOT 5.1
Advanced Software based on two-dimensional organoid images. Statistical analyses
were conducted using GraphPad Prism software (GraphPad Software, La Jolla, CA).
Data are expressed as the mean ± S.D. and p < 0.05 was considered statistically
significant.
Results
Organoids are generated from Lgr5+ cells in both anterior and posterior tongue
of neonatal mice
We sorted Lgr5-EGFP+ cells from all three taste regions including CV, FL and FF
papillae of Lgr5-EGFP-CreERT2 mice at P0. The scheme of cell collection and
culture was shown in Fig.1A. Immunostaining against GFP demonstrated the apparent
Lgr5+ cells in CV, FL and FF papillae of neonatal mice (Fig.S1B, D, F), while Lgr5+
cells were only observed in CV and FL papillae of adults, but not in FF papillae
(Fig.S1A, C, E). Sorted Lgr5+, Lgr5- cells and unsorted cells were cultured according
to our published protocol [21]. Flow cytometry analysis showed that the percentage of
Lgr5-EGFP+ cells was higher in CV (3.71%), rather than in FL (0.87%) and FF
papillae (1.12%) (Fig.1B). Size of organoids derived from Lgr5+ cells of CV papillae
did not show significant difference compared to unsorted or Lgr5- cells-derived
organoids (Fig.S2A, D, p>0.1). Size of organoids from Lgr5+ cells in FL papillae was
significantly increased compared to organoids from Lgr5- cells (p<0.001), but did not
change in contrast to organoids from unsorted cells (p>0.1) (Fig.S2B, D). However,
the size of organoids from Lgr5+ cells in FF papillae was increased compared to
organoids from Lgr5- or unsorted cells (Fig.S2C, D, p<0.001). The growth efficiency
(capacity to form organoids from single cells) in organoids from Lgr5+ cells was
significantly enhanced compared to those from Lgr5- cells or unsorted cells in CV, FL
and FF papillae (Fig.1C, p<0.001). Through immunostaining against taste cell
markers in organoids at Day 14 post in vitro culture, we found the organoids derived
from unsorted cells of CV and FL papillae could express Pan-taste cell maker K8 or
mature taste receptor cell marker Car4 (Fig.S3A, B), while the organoids derived
from FF papillae barely expressed Car4 (Fig.S3C). By contrast, the organoids derived
from non-taste (NT) tissue did not express taste cell markers (Fig.S3D). Similar
results were obtained by quantitative PCR, demonstrating the level of Gustducin- or
Car4-mRNA was enhanced in organoids from CV (p<0.05) or FL papillae (p<0.001)
compared to the NT tissue (Fig.S3F, G). However, we observed the obvious
Entpd2-mRNA level in organoids derived from FF papillae, compared to the NT
tissue (Fig.S3E, p<0.001). Percentage of organoids containing taste cells was much
higher in organoids from Lgr5+ cells. Percentage of organoids containing Gustducin+
mature taste receptor cells was significantly increased in organoids from Lgr5+ cells
of CV (Fig.1D), FL (Fig.1F) and FF papillae (Fig.1H), compared to the counterparts
from Lgr5- cells (Fig.1E, G, I, J, p<0.001). Similarly, percentage of Car4+ organoids
was also increased when derived from Lgr5+ cells in contrast to those from Lgr5-
cells (Fig.1D-I, K, p<0.001). Pan-taste cell marker K8 was expressed in organoids
from Lgr5+ organoids, and the percentage of organoids containing K8+ cells was
significantly lowered in organoids from Lgr5- cells of CV, FL and FF papillae (Figure
1D-I, L, p<0.001). Organoids derived from unsorted cells in FL and CV papillae
showed generation of K8+, Car4+ and Gustducin+ taste cells (Fig.1J-L). Organoids
derived from Lgr5+ cells in FF papillae generated high percentage of Car4+ or
Gustducin+ organoids, while the percentage of Car4+ or Gustducin+ organoids from
unsorted or Lgr5- cells was significantly lower compared to the organoids from Lgr5+
cells (Fig.1J, K, p<0.001). Collectively, these results indicated that Lgr5+ cells from
different regions of neonatal tongue favorably formed organoids containing mature
taste receptor cells in vitro.
Taste cell generation in E-cadherin-expressed organoids derived from Lgr5+
cells
Compared to the taste organoids derived from Lgr5+ cells, the percentage of taste
cells was lower in Lgr5- cells-derived organoids. we therefore determined whether
inclusion of other cell subtypes between Lgr5+ and Lgr5- organoids led to the
discrepancy in taste cell generation. Vimentin marked mesenchymal cells in taste
connective tissue, while E-cadherin marked epithelium cells surrounding taste buds,
indicating Vimentin and E-cadherin defined different cell subtypes in taste tissue. We
found that K8+ taste cells were mostly located in E-cadherin-expressed organoids
generated from Lgr5+ cells in CV or FF papillae (Fig.S4A, B), while Vimentin was
highly expressed in Lgr5- organoids (Fig.S4C, D), as well as in a subset of Lgr5+
organoids from FF papillae (Fig.S4B), suggesting that mesenchymal cells mainly
existed in Lgr5- organoids from CV or FF papillae. However, we found weak
expression of E-cadherin in Lgr5- organoids from CV papillae, but the higher
E-cadherin expression in Lgr5- organoids from FF papillae (Fig.S4C, D). This might
result from the differential epithelial and mesenchymal state of Lgr5- cells in CV and
FF papillae. Thus, in Lgr5+ and Lgr5- organoids from CV papillae, mesenchymal and
epithelium cells were separately defined, while these two types of cells coexisted in
Lgr5+ and Lgr5- organoids from FF papillae.
Preferential generation of taste cells in organoids derived from neonatal CV papillae
Car4+ or Gustducin+ taste receptor cells were present from Day 7 of culture in Lgr5+
cells-derived organoids [13]. In adult, Lgr5 marked the taste stem/progenitor cells in
posterior tongue, but not in anterior FF papillae [19]. Thus, we assessed differences in
taste cell generation in Lgr5+ organoids derived from neonatal and adult CV papillae.
Compared to those from adults, the percentage of taste cells per neonatally derived
organoid was significantly increased. Organoids from neonatal CV papillae showed
4.4±0.3 and 3.2±0.6 fold more Gustducin+ (p<0.001) and Car4+ taste receptor cells
ratio (p<0.01) per organoid at Day 7 (Fig.2A-C). Gustducin- and Car4-mRNA level
was significantly increased in organoids from neonatal CV papillae at Day 7 to Day 9
post in vitro culture, compared to those from adult tissue (Fig.2D, E, p<0.001).
However, the Entpd2-mRNA level (a marker for Type I taste supporting cell) did not
show apparent difference between adult and neonatal organoids (Fig.2F, p>0.1).
RNA-Seq analysis indicated the differentially-expressed genes between organoids
from CV papillae of neonatal and adult mice, including stem/progenitor cell marker
Sox2, Lgr5, Krt14 (Fig.S5A, B), which was also confirmed by quantitative PCR
showing Lgr5-mRNA level was significantly increased in the organoids from neonatal
CV papillae compared to adult-derived organoids at Day 7 to Day 9 post in vitro
culture (Fig.S5C, p<0.001 at Day 7, p<0.01 at Day 8 and Day 9). The genes critical to
taste transduction such as Car4, Gustducin (Gnat3) and Trpm5 were upregulated in
organoids from CV papillae from neonatal mice compared to those from adults
(Fig.2G). Thus, taste organoids from CV papillae of neonatal mice had stronger
capacity to generate taste receptor cells than organoids from adults.
Multiple signaling pathways regulate the generation of taste cells in organoids
Our previous transcriptome analysis on taste organoids demonstrated that multiple
signaling pathways were involved in regulating taste cell differentiation [13].
Accordingly, we elucidated whether these pathways mediated the differential level
of taste transduction genes in organoids from CV papillae of neonatal and adult
mice. KEGG enrichment analysis demonstrated that critical signaling pathways
such as Notch and Wnt were involved in the transcriptional difference between
organoids from neonatal mice and adults (Fig.S5D). Most of the differentially
expressed genes in these critical signaling pathways including Wnt, MAPK,
PI3K-Akt, SHH, Notch and cAMP pathways were upregulated in organoids from
CV papillae of neonatal mice in contrast to organoids from adults (Fig.S5E and
Fig.3). Furthermore, most genes were upregulated in organoids from neonatal mice
at both Day 6 and Day 7, while expression of a few genes were significantly
enhanced at Day 7 but not at Day 6, such as PLCβ1, TCF7L2, WNT11 and FZD1 in
Wnt signaling, GAS1 and PTCH2 in SHH signaling and NOTCH4, MFNG and
JAG1 in Notch signaling (Fig.3). Therefore, above-mentioned signaling pathways
might participate in activating taste transduction gene expression in organoids from
neonatal CV papillae. To elucidate the involvement of these signaling pathways in
the generation of taste receptor cells, we tested the effect of small molecule
inhibitors or activators of these signaling pathways on organoids from CV papillae
of neonatal mice on Day 6 post culture and incubated for 3 days. In the presence of
Wnt activator CHIR99021 or Notch inhibitor LY411575, the percentage of Car4+
cells per organoid was increased by 86±14% (p<0.001) and 61±12% (p<0.05),
while percentage of Gustducin+ cells was increased by 71±19% (p<0.05) and 93±8%
(p<0.001), respectively, compared to the DMSO-treated control organoids
(Fig.4A-C, G, H). By contrast, the percentage of Car4+ taste receptor cells was
reduced in the presence of MAPK inhibitor SB202190, pVc or TGFβ receptor
inhibitor 616452 by 70±8% (p<0.01), 56±9% (p<0.05) and 63±11% (p<0.01)
(Fig.4D-H). Similarly, the percentage of Gustducin+ cells was also decreased by
71±5% (p<0.01), 63±10% (p<0.01) and 86±5% (p<0.001) with the treatment of
SB202190, pVc and 616452, respectively (Fig.4D-H). Moreover, quantitative PCR
data showed that Car4-mRNA level in taste organoids was significantly increased
in the presence of CHIR99021 (p<0.01) or LY411575 (p<0.01), but drastically
decreased with treatment of SB202190 (p<0.001), pVc (p<0.001) or 616452
(p<0.05) compared to the DMSO-treated control (Fig.4I). Similar results were
observed in Gustducin-mRNA level in organoids treated with these drugs (Fig. 4J,
p<0.01 for CHIR99021, p<0.05 for LY411575 and p<0.001 for SB202190, pVc or
616452 treatment). Collectively, these data indicated critical signaling pathways
regulated the generation of taste receptor cells in organoids derived from CV
papillae of neonatal mice.
Notch signaling regulates taste cell generation in organoids from neonatal CV
papillae
To compare the role of Notch signaling in taste cell generation in adult versus
neonatal CV papillae organoids, these organoids were treated with LY411575 starting
at Day 6 in vitro for 3 days. Immunostaining analysis demonstrated that treatment
with LY411575 significantly increased the percentage of Car4+ or Gustducin+ taste
receptor cells by 75±11% (p<0.001) and 118±12% (p<0.01) per organoid from CV
papillae of neonatal mice, while Car4+ or Gustducin+ cell ratio in organoids from CV
papillae of adults was increased by less than 40% (p>0.1) (Fig.5A-F). Besides,
Car4-mRNA level was significantly increased in LY411575-treated organoids from
neonatal CV papillae (p<0.001 at Day 8 and Day 9), while the increase in
Car4-mRNA level in organoids from CV papillae of adults was not significantly
different (Fig.5G). Similarly, the Gustducin-mRNA level was significantly increased
in LY411575-treated organoids from neonatal CV papillae (p<0.001 at Day 7, Day 8
and Day 9), while the Gustducin-mRNA level alteration in organoids from CV
papillae of adults was not significant (p>0.1) (Fig.5H). Thus, inhibition of Notch
signaling preferentially regulated taste receptor cell generation in organoids from CV
papillae of neonatal mice in contrast to organoids from CV papillae of adults.
Participation of critical signaling pathways in LY411575-treated taste organoids
To elucidate the activation of signaling pathways in LY411575-treated taste organoids,
we performed RNA-seq analysis and demonstrated differentially expressed genes in
untreated and LY411575-treated organoids from CV papillae of adult and neonatal
mice (Fig.S6A-C). Most genes involved in taste transduction were highly expressed
with LY411575 treatment in organoid from CV papillae of neonatal mice compared to
the DMSO-treated control organoids (Fig.S6D). However, this was not as obvious as
in LY411575-treated organoids from adults (Fig. S6D). With the incubation of
LY411575, the taste transduction gene expression was increased at Day 8 and Day 10
compared to Day 7 (Fig.6A). KEGG enrichment analysis showed that multiple
signaling pathways were regulated in LY411575-treated organoids from neonatal CV
papillae (Fig.6B). Heatmap demonstrated that many genes were up-regulated in
PI3K-Akt (Fig.6C), Wnt (Fig.6D) and MAPK (Fig.6E) signaling pathways, while
additional genes in these pathways were not increased including PLCβ1, TCF and
PLCβ2 in Wnt signaling, MAP3K and RAPGEF2 in MAPK signaling, SOS2 and
COL1 in PI3K-Akt signaling. These genes still remained lower level in
LY411575-treated organoids from neonatal CV papillae. However, expression of most
genes was drastically enhanced in LY411575-treated organoids and most significantly
increased genes included ITGA3, IRS1, IL6RA in PI3K-Akt signaling, Wnt3a,
CAMK2B, FOSL1 in Wnt signaling as well as FGFR3, MAP4K2, HSPA1B in MAPK
signaling. Collectively, these data indicated that inhibition of Notch signaling by
LY411575 stimulation in organoids from neonatal CV papillae modulated multiple
signaling pathways, implying potential crosstalk in signaling network regulating the
generation of taste receptor cells.
Discussion
In this study, we found preferential generation of taste receptor cells in organoids
from Lgr5+ cells of CV, FL and FF papillae compared to organoids from Lgr5- cells.
Organoids from CV papillae of adult and neonatal mice exhibited differential capacity
to generate taste receptor cells. Meanwhile, the generation of taste receptor cells in
organoids from CV papillae of adult and neonatal mice was affected by multiple
signaling pathways including Notch, and crosstalk among these signaling pathways
might coordinate the taste receptor cell generation. Thus, we concluded that the
generation of taste receptor cells in organoids was age-related and associated with
multiple signaling modulation.
We established a Matrigel-based 3D culture system for generating taste organoids
in vitro isolated from CV papillae of adult mice [21]. Here, we showed that Lgr5+
cells in FF papillae of neonatal mice could form organoids (Fig.1). Considering that
Lgr5+ cells were not present in the anterior tongue of adult [19], it is likely that Lgr5+
cells may enter quiescent state and the expression is diminished in the adulthood.
Furthermore, the organoids from Lgr5+ cells in FF papillae generated significantly
more Car4+ or Gustducin+ taste receptor cells compared to the unsorted cells. This
may be resulted from the mixture of Lgr5+ and Lgr5- cells in organoids led to the
reduced growth efficiency. By comparing the organoids from three taste papillae
isolated from neonatal mice, we found that the significantly less Car4+ or Gustducin+
cells were present in organoids derived from FF papillae, while the NTPDase2+ or
K8+ cells still existed (Fig.S3). This demonstrated unsorted cells from FF papillae led
to the formation of organoids that mostly lack mature taste receptor cells, but
contained NTPDase2+ type I taste supporting cells. The percentage of Car4+ or
Gustducin+ cells in organoids from CV papillae of neonatal mice was significantly
enhanced compared to the organoids from adult at Day 7 post in vitro culture (Fig.2).
This indicated that taste organoids from neonatal mice underwent differentiation into
mature taste cells sooner than the organoids from adults. RNA-seq analysis also
demonstrated expression of genes encoding taste transduction proteins in organoids
from neonatal mice (Fig.2), further supporting our conclusion that organoids from
neonatal CV papillae showed stronger capacity to generate the Car4+ or Gustducin+
taste receptor cells.
Vimentin was present in mesodermal derivatives as well as in perigemmal
epithelial cells[24]. Expression of Vimentin in epithelium was likely associated with
cell migration and differentiation [24], showing its critical role in organ development.
In tongue, the vimentin expression initiated taste bud cell proliferation and therefore
mesenchymal cells may function as progenitors to taste bud cells [24]. Here, we
demonstrated that mesenchymal and epithelium cells were separately defined in
Lgr5+ and Lgr5- organoids from CV papillae, while these two types of cells coexisted
in Lgr5+ and Lgr5- organoids from FF papillae (Fig.S4). This was likely to explain
the percentage of taste receptor cells was not higher in FF papillae organoids
compared to organoids from CV papillae. Cells from taste connective tissue
contributed to FF taste bud formation in early postnatal mice [25]. Since Vimentin
marked taste cells during FF development [26], we hypothesized a special role of
Vimentin in the FF-derived organoids. The Ki67+ cells ratio did not show significant
alteration in organoids derived from CV or FF papillae (Fig.S4), indicating similar
proliferation process during growth.
Multiple signaling transduction pathways participated the taste cell proliferation
and differentiation. Our previous work showed that multiple signaling pathways
including Wnt, BMP, SHH and Notch were involved in taste cell generation [13].
Among these four signaling pathways, Wnt and SHH signaling was activated while
BMP and Notch was inactivated in the process of taste organoid growth. This was
confirmed by our findings that generation of Car4+ and Gustducin+ mature taste
receptor cells in organoids from CV papillae of neonatal mice was enhanced in the
presence of CHIR99021 (glycogen synthase kinase-3 activator potentiating the
upregulation of β-catenin and c-Myc functions [27]) and LY411575 (γ-secretase
inhibitor and Notch inhibitor[28]) (Fig.4). By contrast, taste cell generation was
weakened when treated with pVc, a supplement to keep the stemness and enhance the
Lgr5 expression of cultured organoids [29]. It is likely that pVc treatment enhanced
the stemness maintenance in taste organoids and attenuated the capacity of mature
taste cell generation. 616452 is an ATP-competitive inhibitor of TGF-β type I receptor
[30]. 616452 was reported to be essential to maintain the Lgr5 expression in cochlear
colonies [29]. Secondly, 616452 regulates cell senescence [31]. Accordingly, the
inhibitory effect of 616452 on taste cell generation in vitro may associate with
intensifying stemness and senescence. SB202190 is a MAPK inhibitor, blocking the
protective effect of MAPK against neuronal death [32]. Thus, the reduction in taste
cell generation may result from the weak cell viability in the presence of SB202190.
Compared to the DMSO-treated control organoids, LY411575-treated organoids
displayed active taste transduction (Fig.S6). This is consistent with our
immunostaining data, showing the increase in Car4+ and Gustducin+ cells ratio in
LY411575-treated organoids (Fig.4). This indicated the involvement of Notch
signaling in taste receptor generation. Furthermore, Notch inactivation in taste
organoids also led to transcriptional alteration in other signaling pathways including
Wnt, MAPK and IP3K-Akt (Fig.6), demonstrating the crosstalk among multiple
signals coordinating the receptor cell differentiation in taste organoids. Wnt signaling
was activated in LY411575-treated organoids (Fig.6) and this is consistent with the
increase in taste cell ratio with treatment of Wnt activator and Notch inhibitor (Fig.4).
In LY411575-treated organoids, transcriptome associated with MAPK signaling was
also up-regulated, supporting the finding that MAPK inhibitor suppressed taste cell
generation (Fig.4). Collectively, this study facilitated our understanding for signaling
transduction network mediating taste cell generation.
Conclusion
Multiple factors determine taste receptor cell generation in organoids, including
specific cell subtype to form organoids, the resource of taste tissue, animal age,
activation and inactivation of signaling pathways as well as the crosstalk among
various signaling transduction.
Declarations of interest: none
Author contributions
Wenwen Ren: Conceptualization; Data curation; Formal analysis; Funding acquisition;
Methodology; Writing – original draft.
Quan Liu: Data curation; Formal analysis; Writing – review & editing.
Xiujuan Zhang: Data curation; Formal analysis; Writing – original draft.
Yiqun Yu: Conceptualization; Data curation; Formal analysis; Funding acquisition;
Investigation; Methodology; Project administration; Supervision; Writing – original
draft; Writing – review & editing.
Funding
This work was supported by National Natural Science Foundation of China Grants
(81700894 and 31771155 to YY, 31900714 to WR); Shanghai Municipal Education
Commission, the Shanghai Eastern Scholar Program (to YY); Shanghai Municipal
Human Resources and Social Security Bureau, Shanghai Talent Development Fund
(to YY).
Data availability
All data generated or analyzed during this study were included in this manuscript. All
the sequence data was deposited on NCBI Sequence Read Archive (SRA accession:
PRJNA637120). The original data were available upon request to the Corresponding
Author (YY).
Reference
[1] L.A. Barlow, Progress and renewal in gustation: new insights into taste bud
development, Development 142 (2015) 3620-3629.
[2] D.A. Yarmolinsky, C.S. Zuker, N.J. Ryba, Common sense about taste: from mammals
to insects, Cell 139 (2009) 234-244.
[3] A. Vandenbeuch, C.B. Anderson, J. Parnes, K. Enjyoji, S.C. Robson, T.E. Finger, S.C.
Kinnamon, Role of the ectonucleotidase NTPDase2 in taste bud function, Proc Natl
Acad Sci U S A 110 (2013) 14789-14794.
[4] D.L. Bartel, S.L. Sullivan, E.G. Lavoie, J. Sevigny, T.E. Finger, Nucleoside
triphosphate diphosphohydrolase-2 is the ecto-ATPase of type I cells in taste buds, J
Comp Neurol 497 (2006) 1-12.
[5] A. Taruno, V. Vingtdeux, M. Ohmoto, Z. Ma, G. Dvoryanchikov, A. Li, L. Adrien, H.
Zhao, S. Leung, M. Abernethy, J. Koppel, P. Davies, M.M. Civan, N. Chaudhari, I.
Matsumoto, G. Hellekant, M.G. Tordoff, P. Marambaud, J.K. Foskett, CALHM1 ion
channel mediates purinergic neurotransmission of sweet, bitter and umami tastes,
Nature 495 (2013) 223-226.
[6] M. Kapsimali, L.A. Barlow, Developing a sense of taste, Semin Cell Dev Biol 24 (2013)
200-209.
[7] A.L. Huang, X. Chen, M.A. Hoon, J. Chandrashekar, W. Guo, D. Trankner, N.J. Ryba,
C.S. Zuker, The cells and logic for mammalian sour taste detection, Nature 442 (2006)
934-938.
[8] Y. Oka, M. Butnaru, L. von Buchholtz, N.J. Ryba, C.S. Zuker, High salt recruits
aversive taste pathways, Nature 494 (2013) 472-475.
[9] I. Perea-Martinez, T. Nagai, N. Chaudhari, Functional cell types in taste buds have
distinct longevities, PLoS One 8 (2013) e53399.
[10] E.R. Liman, Y.V. Zhang, C. Montell, Peripheral coding of taste, Neuron 81 (2014)
984-1000.
[11] L.A. Barlow, O.D. Klein, Developing and regenerating a sense of taste, Curr Top Dev
Biol 111 (2015) 401-419.
[12] C.M. Mistretta, H.X. Liu, Development of fungiform papillae: patterned lingual
gustatory organs, Arch Histol Cytol 69 (2006) 199-208.
[13] W. Ren, E. Aihara, W. Lei, N. Gheewala, H. Uchiyama, R.F. Margolskee, K. Iwatsuki,
P. Jiang, Transcriptome analyses of taste organoids reveal multiple pathways involved
in taste cell generation, Sci Rep 7 (2017) 4004.
[14] F. Liu, S.E. Millar, Wnt/beta-catenin signaling in oral tissue development and disease,
J Dent Res 89 (2010) 318-330.
[15] K. Iwatsuki, H.X. Liu, A. Gronder, M.A. Singer, T.F. Lane, R. Grosschedl, C.M.
Mistretta, R.F. Margolskee, Wnt signaling interacts with Shh to regulate taste papilla
development, Proc Natl Acad Sci U S A 104 (2007) 2253-2258.
[16] H.X. Liu, A. Ermilov, M. Grachtchouk, L. Li, D.L. Gumucio, A.A. Dlugosz, C.M.
Mistretta, Multiple Shh signaling centers participate in fungiform papilla and taste bud
formation and maintenance, Dev Biol 382 (2013) 82-97.
[17] Y. Seta, C. Seta, L.A. Barlow, Notch-associated gene expression in embryonic and
adult taste papillae and taste buds suggests a role in taste cell lineage decisions, J
Comp Neurol 464 (2003) 49-61.
[18] M. Kapsimali, A.L. Kaushik, G. Gibon, L. Dirian, S. Ernest, F.M. Rosa, Fgf signaling
controls pharyngeal taste bud formation through miR-200 and Delta-Notch activity,
Development 138 (2011) 3473-3484.
[19] K.K. Yee, Y. Li, K.M. Redding, K. Iwatsuki, R.F. Margolskee, P. Jiang, Lgr5-EGFP
marks taste bud stem/progenitor cells in posterior tongue, Stem Cells 31 (2013)
992-1000.
[20] N. Takeda, R. Jain, D. Li, L. Li, M.M. Lu, J.A. Epstein, Lgr5 Identifies Progenitor Cells
Capable of Taste Bud Regeneration after Injury, PLoS One 8 (2013) e66314.
[21] W. Ren, B.C. Lewandowski, J. Watson, E. Aihara, K. Iwatsuki, A.A. Bachmanov, R.F.
Margolskee, P. Jiang, Single Lgr5- or Lgr6-expressing taste stem/progenitor cells
generate taste bud cells ex vivo, Proc Natl Acad Sci U S A 111 (2014) 16401-16406.
[22] N. Tuysuz, L. van Bloois, S. van den Brink, H. Begthel, M.M. Verstegen, L.J. Cruz, L.
Hui, L.J. van der Laan, J. de Jonge, R. Vries, E. Braakman, E. Mastrobattista, J.J.
Cornelissen, H. Clevers, D. Ten Berge, Lipid-mediated Wnt protein stabilization
enables serum-free culture of human organ stem cells, Nat Commun 8 (2017) 14578.
[23] Y.Y. Fan, L.A. Davidson, R.S. Chapkin, Murine Colonic Organoid Culture System and
Downstream Assay Applications, Methods Mol Biol 1576 (2019) 171-181.
[24] M. Witt, M. Kasper, Distribution of cytokeratin filaments and vimentin in developing
human taste buds, Anat Embryol (Berl) 199 (1999) 291-299.
[25] H.X. Liu, Y. Komatsu, Y. Mishina, C.M. Mistretta, Neural crest contribution to lingual
mesenchyme, epithelium and developing taste papillae and taste buds, Dev Biol 368
(2012) 294-303.
[26] K. Boggs, N. Venkatesan, I. Mederacke, Y. Komatsu, S. Stice, R.F. Schwabe, C.M.
Mistretta, Y. Mishina, H.X. Liu, Contribution of Underlying Connective Tissue Cells to
Taste Buds in Mouse Tongue and Soft Palate, PLoS One 11 (2016) e0146475.
[27] S. Ye, L. Tan, R. Yang, B. Fang, S. Qu, E.N. Schulze, H. Song, Q. Ying, P. Li,
Pleiotropy of glycogen synthase kinase-3 inhibition by CHIR99021 promotes
self-renewal of embryonic stem cells from refractory mouse strains, PLoS One 7 (2012)
e35892.
[28] C.L. Curry, L.L. Reed, T.E. Golde, L. Miele, B.J. Nickoloff, K.E. Foreman, Gamma
secretase inhibitor blocks Notch activation and induces apoptosis in Kaposi’s sarcoma
tumor cells, Oncogene 24 (2005) 6333-6344.
[29] W.J. McLean, X. Yin, L. Lu, D.R. Lenz, D. McLean, R. Langer, J.M. Karp, A.S.B. Edge,
Clonal Expansion of Lgr5-Positive Cells from Mammalian Cochlea and High-Purity
Generation of Sensory Hair Cells, Cell Rep 18 (2017) 1917-1929.
[30] J.K. Ichida, J. Blanchard, K. Lam, E.Y. Son, J.E. Chung, D. Egli, K.M. Loh, A.C. Carter,
F.P. Di Giorgio, K. Koszka, D. Huangfu, H. Akutsu, D.R. Liu, L.L. Rubin, K. Eggan, A
small-molecule inhibitor of tgf-Beta signaling replaces sox2 in reprogramming by
inducing nanog, Cell Stem Cell 5 (2009) 491-503.
[31] X. Hua, C.B. Thompson, Quiescent T cells: actively maintaining inactivity, Nat
Immunol 2 (2001) 1097-1098.
[32] F. Shigiyama, M. Hamanoue, M. Kobayashi, K. Takamatsu, Cell-permeable p38 MAP
kinase protects adult hippocampal neurons from cell death, Neurosci Lett 699 (2019)
115-121.
Figure legends
Figure 1. Characterization of taste organoids derived from Lgr5+, Lgr5- and unsorted
cells from CV, FL and FF papillae of neonatal mice. (A) Schematic view showing the
3D culture of taste organoids. (B) FACS indicated the percentage of Lgr5-EGFP+
cells sorted from CV, FL and FF papillae from the tongue of Lgr5-EGFP-CreERT2
mice. (C) Statistical analysis of organoid size derived from Lgr5+, Lgr5- and unsorted
cells (n=3 independent experiments). (D-I) Confocal images of K8+, Car4+ and
Gustducin+ cells in Lgr5+ and Lgr5- cells-derived organoids from CV (D, E), FL (F,
G) and FF (H, I) papillae. (J-L) Statistical analysis of Gustducin+, Car4 and K8+
organoids derived from CV, FL and FF papillae (n=3 independent experiments). In
each group (Lgr5+, Lgr5- and unsorted), organoids from 9 wells of 24-well plates
were used to count the number of organoids and measure the percentage of organoids
containing positively stained cells. The statistical difference was determined by
two-way ANOVA with Tukey’s multiple comparisons test. ns, not significant, *p<0.05,
**p<0.01, ***p<0.001. Scale bars, 20 μm.
Figure 2. Generation of taste cells in organoids from CV papillae of adult and
neonatal mice from Day 7 to Day 9 post in vitro culture. (A, B) Confocal images of
Ki67+, Gustducin+ and Car4+ cells in organoids derived from CV papillae of adult
and neonatal mice at Day 7 after culture. (C) Statistical analysis of Car4+ and
Gustducin+ cell ratio in organoids derived from CV papillae of adult and neonatal
mice at Day 7 (n=3 independent experiments). In each group, organoids from 9 wells
of 24-well plates were used to measure the percentage of positively stained cells. (D-F)
Quantitative PCR showing the alteration in Gustducin-, Car4- and Entpd2-mRNA
levels in organoids from CV papillae of adult and neonatal mice at Day 7, 8 and 9
(n=4 independent experiments). (G) RNA-seq analysis showed the transcriptional
difference in taste transduction in organoids from CV papillae of adult and neonatal
mice at Day 6 and Day 7 post culture. The statistical difference was determined by
two-way ANOVA with Sidak’s multiple comparisons test. ns, not significant,
**p<0.01, ***p<0.001. Scale bars, 20 μm.
Figure 3. RNA-seq analysis showed differentially expressed genes participating in
multiple signaling pathways in organoids from CV papillae of adult and neonatal mice.
Genes involved in Wnt (A), MAPK (B), PI3K-Akt (C), SHH (D), Notch (E) and
cAMP (F) signaling pathways were differentially expressed in organoids from CV
papillae of adult and neonatal mice at Day 6 and Day 7 after in vitro culture.
Figure 4. Chemical cocktail affected taste cell generation in organoids. (A-F)
Confocal images of K8+, Car4+ and Gustducin+ cells in organoids from neonatal CV
papillae in the presence of DMSO, CHIR99021, LY411575, SB202190, pVc and
616452. (G, H) Statistical analysis of Car4+ or Gustducin+ cell ratio per organoid
treated with various compounds (n=3 independent experiments). In each chemical
stimulation group, organoids from 9 wells of 24-well plates were used to measure the
percentage of positively stained cells. (I, J) Quantitative PCR analysis showed the
Car4- or Gustducin-mRNA level in organoids from CV papillae of neonatal mice,
treated with different chemicals (n=4 independent experiments). The statistical
difference was determined by one-way ANOVA with Dunnett’s multiple comparisons
test. *p<0.05, **p<0.01, ***p<0.001. Scale bars, 20 μm.
Figure 5. The differential effect of LY411575 on the generation of taste cells in
organoids from CV papillae of adult and neonatal mice. (A-D) Confocal images of
Ki67+, Gustducin+ and Car4+ cells in organoids from CV papillae of adult and
neonatal mice, with or without the stimulation of LY411575. (E, F) Statistical analysis LY450139
of Car4+ or Gustducin+ cell percentage in organoids from CV papillae of adult and
neonatal mice in the presence of LY411575 (n=3 independent experiments). In each
group, organoids from 9 wells of 24-well plate were used to measure the percentage
of positively stained cells. (G, H) Quantitative PCR analysis of Car4- and
Gustducin-mRNA in organoids with or without treatment of LY411575 (n=4
independent experiments). The statistical difference was determined by two-way
ANOVA with Sidak’s multiple comparisons test in (E) and (F), and with Tukey’s
multiple comparisons test in (G) and (H). ns, not significant, ***p<0.001. Scale bars,
20 μm.
Figure 6. RNA-seq showed the transcriptional alteration in LY411575-treated
organoids from neonatal CV papillae. (A) Heatmap showed the alteration in taste
transduction of LY411575-treated and untreated organoids at Day 7, Day 8 and Day
10 post in vitro culture. (B) KEGG enrichment analysis indicated the multiple
signaling pathways were regulated in LY411575-treated organoids. (C-E) Heatmap
showed up-regulated genes participated in PI3K-Akt, Wnt and MAPK signaling
pathways.