In line with this argumentation, methanol-inducible GlpXP carries SBPase activity, which is relevant in the RuMP pathway [28], while the chromosomally encoded GlpXC is the major FBPase in gluconeogenesis and is not methanol-inducible. Methods Microorganisms and cultivation conditions B. selleck chemicals methanolicus strains were grown at 50°C in the following media. SOBsuc medium is SOB medium (Difco) supplemented with 0.25 M sucrose. Bacterial growth was performed in shake flasks (500 ml) in 100 ml medium at 200 r.p.m. and monitored by
measuring the OD600. The inoculation of the precultures for all growth experiments of B. methanolicus strains was performed with frozen ampules of B. methanolicus as a starter culture. Ampules of selleck compound B. methanolicus cells were prepared from exponentially growing cultures (OD600 1.0 to 1.5) and stored at -80°C in 15 % (v/v) glycerol [22]. For inoculation, ampules were thawed and 250 μl cell suspension was used to inoculate 100 ml medium. The E. coli strain DH5α was used as a standard cloning host [59]. Recombinant cells were grown in lysogeny broth (LB) medium at 37°C
supplemented with ampicillin (100 μg/ml), kanamycin (50 μg/ml), spectinomycin (100 μg/ml), and 1 mM IPTG when appropriate. Recombinant E. coli Romidepsin price procedures were performed as described elsewhere [60]. Recombinant protein production was carried out with E. coli BL21 (DE3) as the host [61]. Bacterial strains and plasmids used in this work are listed in Table 1 and oligonucleotides for PCR and cloning are listed in Table 3. Table 3 List of oligonucleotides used Name Sequence (5’-3’) pET16b_Fw GCTAACGCAGTCAGGCACCGTGTA pET16b_Rv GACTCACTATAGGGGAATTGTGAGCG tktC_Fw_XhoI CCGGCTCGAG TTGTTTGATAAAATTGACCAT tktC_Rv_XhoI Meloxicam CCGGCTCGAG TTATTGTTTAAGTAAAGCT tktP_Fw_XhoI
GCGCCTCGAG GTGCTCCAACAAAAAATAGAT CG tktP_Rv_XhoI GGCGCTCGAG TTAGAGAAGCTTTTTAAAATGAGAAA tkt_C_Seq1 GCGTCATTTGGCAGCGGTATATAAT tkt_C_Seq2 TCTAGGTCCTGAAGAACGAAAGC tkt_C_Seq3 GGCTCGGCAGATCTTGCTAGTTC tkt_P_Seq1 CCCTCATACGCTTTTTCAGAATC tkt_P_Seq2 GCTAGAGCATTTAACACTGCACC tkt_P_Seq3 CGATCTTGAACACTCTCACTAAATG gapb_fw GCGACTCGAG ATGACCGTACGCGTAGCGATAA gapb_rv GCGTCTCGAG TTACCTGAAAGCAACAGTAGC Restriction sites are highlighted in italics, stop and start codons are underlined. Homologous overexpression of tkt C and tkt P in B. methanolicus Overexpression vector pTH1 was used to allow methanol inducible expression of B. methanolicus TKT genes. This vector is analogous to the plasmid pHP13, in which the strong mdh promoter was cloned in-frame with the mdh rbs region to allow methanol inducible expression in B. methanolicus[20, 39]. The DNA fragments of the tkt C and tkt P coding regions were amplified from DNA of B.