, 2005). Amplified gene products were cleaned using the Wizard® SV Gel and PCR Clean-Up System (Promega). Nucleotide sequence analysis of the purified PCR products was performed at the Australian Genome Research Facility using an AB3730xl DNA analyzer (Applied Biosystems, CA). For four isolates representing each Mycobacterium phylotype, the β-ketosynthase

(KS) domain of type I PKS was retrieved via PCR with the degenerate primer set degKS2F.i (GCIATGGAYCCICARCARMGIVT) http://www.selleckchem.com/products/GDC-0980-RG7422.html and degKS5R.i (GTICCIGTICCRTGISCYTCIAC) under the conditions described by Schirmer et al. (2005). The amplified products were visually assessed by gel electrophoresis, and amplicons of the correct size (700 bp) were cleaned and cloned into pGEM-T Easy Vector (Promega) following the manufacturer’s instructions. Nucleotide sequencing was performed with the primers T7 (TAATACGACTCACTATAGGG) and SP6 (ATTTAGGTGACACTATAG) after purification of the plasmid using the Wizard®Plus SV Minipreps DNA Purification System (Promega). Nucleotide sequences were deposited in the GenBank database under accession numbers

HM210415–HM210460. The sequences of the 16S rRNA gene from isolates were aligned against the reference sequences retrieved from The Ribosomal Database Project (Cole et al., 2009), using the greengenes program (DeSantis et al., 2006), followed by Lane masking to remove any hypervariable region from the alignment (Lane, 1991). The dataset was exported into the phylip program (Felsenstein, 1989) for sequence similarity analysis. For the phylogenetic Buparlisib analysis based on the concatenation of the three genes, reference sequences were obtained from the NCBI database associated with the study of Mignard & Flandrois (2008). Sequence alignment for each gene was performed using clustal

x (Larkin et al., 2007). Aligned sequences for the three genes were concatenated and aligned again as single sequences. Phylogenetic trees were generated using the mega4.1 program (Tamura et al., 2007) for the neighbor-joining and maximum parsimony methods and the MRIP treefinder program (Jobb et al., 2004) for the maximum likelihood method with the HKY model of substitution. Bootstrapping was performed using 1000 replicates. For the KS gene, translated protein sequences were derived from nucleotide sequences using the orf finder available at the NCBI website (http://www.ncbi.nlm.nih.gov/projects/gorf/). Phylogenetic trees were reconstructed from a clustal x alignment of translated KS protein sequences including the reference sequences obtained from the NCBI-available genome annotations using the mega4.1 and treefinder programs with the JTT model of substitution for the maximum likelihood calculation. The Salinispora isolate AQ1M05 was heavily inoculated on one quarter segment of an SYP agar plate and grown for 3 weeks at 28 °C.